2024 Marinobacter antarcticus

Marinobacter antarcticus

Author: fyef

August undefined, 2024

Web1 aug. 2016 · The genus Marinobacter was proposed by Gauthier et al. (1992) to accommodate Gram-negative, aerobic, moderately halophilic gammaproteobacteria that use several hydrocarbons as sole sources of carbon and energy. Recently, several new species have been added to the genus Marinobacter, for example, Marinobacter adhaerens … WebHistorique. La recherche de bactéries capables de dégrader les hydrocarbures, le long des côtes françaises, a conduit à l'isolement d'une souche d'abord appelée Alteromonas souche SP.17 à proximité d'une raffinerie pétrolière [1].Sa caractérisation a démontré qu'il s'agit d'une souche appartenant à une nouvelle espèce qui a été appelée Marinobacter …

Draft Genome Sequences of Marinobacter similis A3d10T and Marinobacter …

WebMarinobacter antarcticus strain ZS2-30 16S ribosomal RNA gene, partial sequence FJ196022 1506 GenBank. 564117 tax ID: Genome sequence information: Sequence accession description Seq. accession number Assembly level Sequence database Associated NCBI tax ID [Ref.: #66792] ... WebTwo Gram-negative, cold-adapted, moderately halophilic, aerobic bacteria, designated strains M3B(T) and M3T, were isolated from marine sediment collected from the South … cel realizacji projektu

Species: Marinobacter antarcticus - List of Prokaryotic names with ...

WebGlobal Biodiversity Information Facility. Free and Open Access to Biodiversity Data. WebMarinobacter antarcticus (Q26816888) From Wikidata. Jump to navigation Jump to search. species of Gammaproteobacteria. edit. Language Label Description Also known … Web22 mei 2013 · The Marinobacter genus comprises widespread marine bacteria, found in localities as diverse as the deep ocean, coastal seawater and sediment, hydrothermal settings, oceanic basalt, sea-ice, sand, solar salterns, and oil fields. Terrestrial sources include saline soil and wine-barrel-decalcification wastewater. The genus was … celso mizutani koga

Biogeochemical implications of the ubiquitous colonization of …

Web10 jul. 2001 · Six strains in this cluster were tested for naphthalene degradation: strain S-36W (gv) and five relatives from the arctic (N) and antarctic (S) that were identified as Marinobacter strains based on membrane fatty acid analyses: N22-B5, N21-B9, N21-F4, SPS1A, and SPS1B [19]. All of these strains were negative for naphthalene degradation. … WebThe glaciers in China have an important role as one of the most climate-sensitive constituents of the Tibetan Plateau which is known as the Asian Water Tower. Although the cryosphere is one of the most extreme environments for organisms, the soils of the glacier foreland harbor surprisingly rich microbiomes. A large amount of accelerated glacier … celsius značkaWebMarinobacter antarcticus: meta-databases: BacDive: Marinobacter antarcticus CGMCC 1.10835: organism-specific: BioCyc: GOLD: Go0044339: organism-specific: Genomes … celso amorim ukraine

"WebBrine assemblages of ultrasmall microbial cells within the ice cover of Lake Vida, Antarctica . The anoxic and freezing brine that permeates Lake Vida's perennial ice below 16mcontains an abundance of very small (≤0.2-μm) particles mixed with a less abundant population of microbial cells ranging from>0.2 to 1.5 μmin length. " - Marinobacter antarcticus

Marinobacter antarcticus

Web17 apr. 2013 · The type strain of Marinobacter persicus is strain M9BT (=IBRC-M 10445T = CCM 7970T = CECT 7991T = KCTC 23561T). A Gram-negative ... Liu A, Li GW, Chen XL, Chen B, Zhou BC, Zhang YZ (2012) Marinobacter antarcticus sp. nov., a halotolerant bacterium isolated from Antarctic intertidal sandy sediment. Int J Syst Evol Microbiol … Webabyssalis strain KJE, Marinobacter salarius strain NP2024, and Marinobacter salaries strain AT3901, isolated from deep-sea sediment near the western flank of the Mid Atlantic Ridge. Microbiol Resour Announc 10: ... o Expedition NBP-2301 to Ross Sea, disembarking at McMurdo Station in Antarctica Presentations: Oral Presentations:

Did you know?

Web6 dec. 2024 · Octadecabacter antarcticus Prevotella MK613346.1 MK613347.1 Prevotella scopos MK613348.1 Pedobacter chitinilyticus MK613349.1 Tenacibaculum sp. 4G03 MK618657.1 MK618658.1 ... Marinobacter sp. CS412 NC041878.1 Pectobacterium carotovorum subsp. carotovorum PC1 NC041880.1 Xenorhabdus sp. KK7.4 … WebMarinobacter antarcticus is a Gram-negative, aerobic, halotolerant, rod-shaped and motile bacterium from the genus of Marinobacter which has been isolated from …

Web44441. 82. 7. 299. 238. 37. CTAGCATAACCCCTTGGGGCC GGAATTGTTATCCGCTCACAATTCCCCTATAG Bacillus megaterium Desulfobacterium vacuolatum DSM 3385 pET-28a(+) DSM 771 ... Web14 jan. 2015 · Oleispira antarctica RB-8. 376 7 43210 TrEMBL Show Sequence - A0A448I9Z6 pBLAST. A0A448I9Z6_MYCCI Mycolicibacterium chitae. 410 0 45629 TrEMBL Show Sequence - A0A2N7W548 pBLAST.

Webname taxonomy_id taxonomy_lvl kraken_assigned_reads added_reads new_est_reads fraction_total_reads [Ruminococcus] gnavus 33038 S 7691179 616234 8307413 0.21418 [Ruminococcus] torq WebRecent studies have demonstrated that heterotrophic bacteria can support prolonged Synechococcus growth by establishing metabolic mutualism for nutrient exchange (3, 7).For example, bacterial mineralization of Synechococcus-derived nitrogen-rich organic matter sustained Synechococcus sp. WH7803 growth for approximately 200 days ().Similarly, in …

WebMarinobacter antarcticus sp. nov., a halotolerant bacterium isolated from Antarctic intertidal sandy sediment. Int J Syst Evol Microbiol 2012; 62 :1838-1844. Linking: To …

WebIn Antarctic regions, the composition and metabolic activity of microbial assemblages associated with plastic debris (“plastisphere”) ... Sequences related to oil degrading bacteria (Alcanivorax,Marinobacter) confirmed the known anthropogenic pressure in … celsius poke bowl \u0026 boba barWeb10 dec. 2024 · A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. celu konkaWebMarinobacter sp. W1-16 from Antarctic surface seawater was analysed for the production of extracellular polymeric substances (EPSs). Enhancement of the EPS biosynthesis … celular 6120 naranjaWebMarinobacter hydrocarbonoclasticus SP17 forms biofilms specifically at the interface between water and hydrophobic organic compounds ... microcosm studies using Antarctic coastal seawater contaminated with diesel or crude oil were conducted in Kerguelen Archipelago (49°22′S, 70°12′E). celulares kodak opinionesWebChikungunya fever is a major public health issue in India. Re-emergence of chikungunya virus (CHIKV) in West Bengal was detected after 32 years in 2006. After 2010, this infection was in apparent decline, but in 2016 a massive outbreak affected the country. Present study was carried out to understand CHIKV infection dynamics during recent ... celticsjeremyMarinobacter antarcticus is a Gram-negative, aerobic, halotolerant, rod-shaped and motile bacterium from the genus of Marinobacter which has been isolated from Antarctic sediments. celui karaokeWebMarinobacter antarcticus is a Gram-negative, aerobic, halotolerant, rod-shaped and motile bacterium from the genus of Marinobacter which has been isolated from Antarctic sediments.[1][2][3] For faster navigation, this Iframe is preloading the Wikiwand page for Marinobacter antarcticus . celulares lg na loja magazine luiza